cancer cell line encyclopedia (Broad Institute Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Broad Institute Inc cancer cell line encyclopedia
Cancer Cell Line Encyclopedia, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cancer+cell+line+encyclopedia/cancer+cell+line+encyclopedia/pm40597801-96-10-25
Average 90 stars, based on 1 article reviews

cancer cell line encyclopedia - by Bioz Stars, 2026-10

90/100 stars

Images

RNA Sequencing:

Article Title: Complex I Drives Glutamine-Dependent TCA Cycle to Support Viability of MYC high Breast Cancer Cells
Article Snippet: .. Next, we sourced RNA-seq data for cell lines from Cancer Cell Line Encyclopedia (CCLE; Broad Institute, 1009 cell lines) and for TNBC samples from The Cancer Genome Atlas Program (TCGA; NIH, 105 samples) and, subsequently, computed with the ssGSEA method the enrichment scores (ES) both for the MYC V1V2 signature and separately for all 26 mitochondrial respiration gene sets. ..

Expressing:

Article Title: Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survival
Article Snippet: .. Cell line EpCAM expression was accessed through the publicly available Cancer Cell Line Encyclopedia (CCLE, https://portals.broadinstitute.org/ccle ) at the Broad Institute (Data S2C). .. EpCAM expression from NCI-60 cell line panel ( GSE32474 ) was accessed, data was plotted using GraphPad.

Article Title: Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survival.
Article Snippet: .. Cell line EpCAM expression was accessed through the publicly available Cancer Cell Line Encyclopedia (CCLE, https:// porta ls. broad insti tute. org/ ccle) at the Broad Institute (Data S2C). .. EpCAM expression from NCI-60 cell line panel (GSE32474) was accessed, data was plotted using GraphPad.

Article Title: Reappraisal of clinicopathological relevance of RON expression in upper tract urothelial carcinoma
Article Snippet: .. Using data mining from the Cancer Cell Line Encyclopedia (Novartis/Broad, Nature 2012), urothelial cancer cell lines showed various distributions of RON mRNA expression (Fig. 3A). ..

Amplification:

Article Title: Complex I Drives Glutamine-Dependent TCA Cycle to Support Viability of MYC high Breast Cancer Cells
Article Snippet: The inhibitors used were metformin (MedchemExpress, HY-17471A), BAY 87-2243 (MedChemExpress, HY-15836), mubritinib (MedChemExpress, HY-13501), rotenone (MedChemExpress, HY-B1756) and CB-839 (MedChemExpress, HY-12248). .. MYC amplification status was obtained from Cancer Cell Line Encyclopedia (CCLE) by Broad Institute . .. Total RNA was extracted using RNeasy Mini Kit (74104, Qiagen) according to the manufacturer’s instructions.

other:

Article Title: Integrative machine learning reveals the biological function and prognostic significance of α‑ketoglutarate in gastric cancer
Article Snippet: To screen potential therapy agents for patients with high AKGI scores, expression data from human cancer cell lines sourced from the Broad Institute's Cancer Cell Line Encyclopedia (https://sites. broadinstitute.org/ccle) was utilized.

Functional Assay:

Article Title: Identification of non-canonical peptides with moPepGen.
Article Snippet: Nature Biotechnology Brief Communication https://doi.org/10.1038/s41587-025-02701-0 Ex te nd ed D at a Ta bl e 1 | F ea tu re c om pa ris on o f c us to m d at ab as e ge ne ra tio n al go rit hm s A lg or ith m / Fe at ur e m oP ep G en cu st om Pr oD BJ 16 –1 8 M ax Q ua nt m od ul e1 9 Pr ot eo D is co 20 Pr ot eo m eG en er at or 23 1,3 3 py pg at k2 1 py Q U IL TS 22 sa m pl es pe ci fic D BG en er at or 23 –2 5 sa pF in de r / PG A 26 ,2 7 sp lic eD B2 8, 29 Sp rit z3 0 N eo D is c3 2 D N A Si ng le N uc le ot id e Va ria nt s ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ D N A Sm al l In se rt io ns / D el et io ns ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ RN A Po in t Va ria nt sa ✓ ✓ Al te rn at iv e Sp lic e Ju nc tio ns ✓ ✓ ✓ ✓ ✓ ✓ ✓ Fu si on Tr an sc rip ts ✓ ✓ ✓ ✓ ✓ ✓ ✓ C irc ul ar R N As ✓ Su pp or te d Va ria nt C om bi na tio ns An y co m bi - na tio ns b N on e Al l S N Vs on ly c Al l S N Vs on ly c Al l v ar ia nt s o nl yc N on e Si ng le SN V w ith sp lic in g or fu si on d N on e N on e Al l v ar ia nt s on ly c N on e Al l va ria nt s on ly c M od ul ar Su pp or t f or N ew In pu t F or m at s ✓ ✓ N on co di ng Tr an sc rip t Th re eFr am e Tr an sl at io n ✓ ✓ ✓ ✓ ✓ N on co di ng Tr an sc rip t w ith Va ria nt se ✓ ✓ ✓ Al te rn at iv e Tr an sl at io n W > Ff ✓ Ex po rt O nl y N on -c an on ic al Pr ot eo ty pi c Pe pt id es ✓ ✓ ✓ ✓ Su m m ar y of D at ab as e G en er at io n ✓ ✓ ✓ ✓ ✓ Vi su al iz at io n of D at ab as e G en er at io n ✓ ✓ ✓ D at ab as e Sp lit tin g fo r Ti er ed F al se D is co ve ry R at e C on tr ol ✓ Fi lte r F AS TA b y RN A Ab un da nc e ✓ ✓ ✓ ✓ a R N A Po in t V ar ia nt s: v ar ia nt s at s in gl enu cl eo tid e po si tio ns w ith in R N A se qu en ce s (fo r e xa m pl e, R N A ed iti ng ). .. Nature Biotechnology Brief Communication https://doi.org/10.1038/s41587-025-02701-0 Extended Data Fig. 7 | Functional investigation of non-canonical peptide detection in Cancer Cell Line Encyclopedia. a) Gene effect CERES scores for genes with detected non-canonical peptides (orange), detected canonical peptides only (pink) and no detected peptides (gray). .. e N on co di ng T ra ns cr ip t w ith V ar ia nt s: n on -c an on ic al p ep tid es d er iv ed fr om n ov el o pe n re ad in g fr am es in n on co di ng tr an sc rip ts h ar bo rin g ad di tio na l D N A an d/ or R N A va ria nt s. f W > F: tr yp to ph an -to -p he ny la la ni ne s ub st itu ta nt s4 6 Nature Biotechnology Brief Communication https://doi.org/10.1038/s41587-025-02701-0 a b c d Peptide Cleavage Graph Transcript Variant Graph AGTCATAAGTTCCATGTGGAATAGCCGGCTGCAACGGA CG CTAT A TT CCGAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA GTCATAAGTTCCATGTGGAATAGCCGGCTGCAACGG ACG ATTTA C CTAT A TT CCGAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA TCATAAGTTCCATGTGGAATAGCCGGCTGCAACGGACGCTATATTCCGAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA C C C reading-frame-0 Variant Bubbles Aligned and Expanded AGTCATAAGTTCCATGTGGAATAGCCGGCTGCAACG GACGCTATATTC GACGCC GACGCTATCTTC CGAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA CGGATTTACGCTATATTC CGGATTTACGCTATCTTC CGGATTTACGCC CGGACGCCC CGGACGCTATCTTCC CGGACGCTATATTCCGTCATAAGTTCCATGTGGAATAGCCGGCTGCAA GAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA TCATAAGTTCCATGTGGAATAGCCGGCTGCAACGGACGCTATATTCCGAGCAGAAAACGACCCCGATATAGATCCGATTGTATCCA Peptide Variant Graph SHKFHVE*PAAT DAIF RAENDPDIDPIVS DA DAIF RIYAIF RIYAIF RIYA RTP RTLSS RTLYSVISSMWNSRLQ EQKTTPI*IRLYP S*VPCGIARCNGRYIPSRKRPRYRSDCI SHK FHVE * PAATDAIFR

Review